Skip to main content

Advertisement

Table 1 The PCR primers

From: P66Shc expression in diabetic rat retina

Primer F/R Sequcence (5′-3′)
GAPDH F TTCCTACCCCCAATGTATCCG
R CATGAGGTCCACCACCCTGTT
P66Shc F TGTCAATAAGCCCACACGAGG
R CTTCACACACCAAACTGATAGCCT