Skip to main content

Advertisement

Table 2 Primer sequences and condition used for PCR and Sanger sequencing of UBIAD1 gene

From: Schnyder corneal dystrophy and associated phenotypes caused by novel and recurrent mutations in the UBIAD1 gene

Target Forward primer Reverse Primer Size (bp) Enzyme Annealing Temp
exon 1 CCGTCCTTCCTCCTTCCC AAGCCACCTTTGACATCCCT 700 GoTaqGreen 65 °C
exon 2 CCACCTGCACAGTCTAAGGA CTGCCAAATCACATTCCTTCCT 689 GoTaqGreen 60 °C