Skip to main content

Advertisement

Table 1 Primers used in Sanger tests of TGFBI gene

From: Multiple phototherapeutic keratectomy treatments in a Chinese pedigree with corneal dystrophy and an R124L mutation: a 20-year observational study

Prime Forward Reverse
TGFBI-1 GTCGCTAGCTCGCTCGGTG CTCCCAGGGTCTCGTAAAGGTT
TGFBI-2 CTGTCCAGCAGCCCTACCACT TTGCATGGTGGTCGGCTTT
TGFBI-3 CTAATGGGATTGTAACTGTGAACTG CGTTGATAGTGAGCATGTCCC
TGFBI-4 GTGTGCTGAAGCCATCGTTG GGCCAGCTGGTCTTTAATTATGT
TGFBI-5 TCTGTATTCAAAGATGGAACCCCT AAAGACTGTGTAGACTCCTTCCCG
TGFBI-6 AAGGGAGACAATCGCTTTAGCAT CTGAGGTCTGTTGGCTGGAGG
TGFBI-7 TCCATGTCATCACCAATGTTCTG TCTCCCTCCTCCCCCACAT
TGFBIQ AAGGGAGACAATCGCTTTAGCAT CCTCCGCTAACCAGGATTTCAT