Skip to main content

Advertisement

Table 1 List of primers and PCR amplification conditions used for VSX1 gene amplification

From: Analysis of the VSX1 gene in sporadic keratoconus patients from China

Exon Sequence of primers (5′-3′) Annealing temperature (°C) Product length (bp)
1 CAGCTGATTGGAGCCCTTC(sense) 62 599
CTCAGAGCCTAGGGGACAGG(antisense)
2 CTTAAGTACCCAAGAGGTTCATAACT(sense) 62 269
GAAACCACTGGGCCTGCTATCAT(antisense)
3 AAGCAGGCACGGTGGTCCTTA(sense) 63 293
AAGGGACTGCTGATTGGCTCACT(antisense)
4 GCTCGGGAGAGAAGATCC(sense) 62 399
TCAGTAAACTGACGTTGCTTG(antisense)
5 GGAAATTTACTTCATTGCTGAATTT(sense) 60 495
TGGCATTGCATTTTATCTTGACA(antisense)