Skip to main content

Advertisement

Table 1 The sequences of primers for RT-PCR

From: Investigation of the anti-cataractogenic mechanisms of curcumin through in vivo and in vitro studies

Primer sequence (5′-3′) Gene
TTT CTG GCT CTC AGG GTG TT HSP70-f
CTG TAC ACA GGG TGG CAG TG HSP70-r
GACTTCGCCGAGATGTCCAGC Bcl-2-f
CCGAACTCAAAGAAGGCCACAAT Bcl-2-r
GTGCTATTGTGAGGCGGTTGT Caspase 3-f
TCCATGTATGATCTTTGGTTC Caspase 3-r
AGAAGGCTAAAGGAAACGAA c-Met-f
GGACCGTCAAGAAGTAAATAAA c-Met-r
CCCTGAGCATCTACGGTTTG Cox-2-f
CAGTATTAGCCTGCTTGTCT Cox-2-r
ATTTATGCAATAAGACCTATTCT Slug-f
AGGCTCACATATTCCTTGTCACA Slug-r
CTGACGGCAACTTCAACTGGG Bax-f
GGAGTCTCACCCAACCACCCT Bax-r