Skip to main content

Advertisement

Table 1 The primers used for real-time PCR

From: Evaluation of the antioxidant effects of different histone deacetylase inhibitors (HDACis) on human lens epithelial cells (HLECs) after UVB exposure

Gene Primer F Primer R Size (bps)
BCL2 5’ GACTTCGCCGAGATGTCCAG 3’ 5’ GCCGGTTCAGGTACTCAGTC 3’ 220
BAX 5’ AGACCGTGACCATCTTTGTG 3’ 5’ TCCCGAAGGAGGTTTATTACCC 3’ 226
caspase 3 5’ AACTGGACTGTGGCATTGAG 3’ 5’ ACAAAGCGACTGGATGAACC 3’ 161
SOD1 5’ GGTGCTGGTTTGCGTCGTAG 3’ 5’ GCCTTCGTCGCCATAACTCG 3’ 102
FOXO3a 5’ CCAGGGTAAAGTCAAGTG 3’ 5’ GCAGGGTCTCAACATAAG 3’ 210
MT2 5’ CCTGCAAATGCAAAGAGTG 3’ 5’ ATCCAGGTTTGTGGAAGTC 3’ 189
GAPDH 5’ CACCCACTCCTCCACCTTTG 3’ 5’ CCACCACCCTGTTGCTGTAG 3’ 110